View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17947_low_24 (Length: 238)
Name: NF17947_low_24
Description: NF17947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17947_low_24 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 6858543 - 6858318
Alignment:
| Q |
18 |
gattgttcattgtgattgctggttgaggattgtcgatttcagttcgatttcgtttttgtagaggaggcattgatgatgatgatataagcttaggttttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6858543 |
gattgttcattgtgattgctggttgaggattgtcgatttcagttcgatttcgtttttgtagaggaggcattgatgatgatgatataagcttaggttttga |
6858444 |
T |
|
| Q |
118 |
agtgtgaaatggacagtgagacttcaacggtcgagttcagtgagtgggtttgatatggaatttcgaagtggagggagact------gtgggagggaagag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
6858443 |
agtgtgaaatggacagtgagacttcaacggtcaagttcagtgagtgggtttgatatggaatttcgaagtgga-ggagactatggtaatgggagggaagag |
6858345 |
T |
|
| Q |
212 |
agaatgtccaaaattaatggacttggt |
238 |
Q |
| |
|
|||||||||||||||||||| |||||| |
|
|
| T |
6858344 |
agaatgtccaaaattaatggccttggt |
6858318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 6887594 - 6887529
Alignment:
| Q |
26 |
attgtgattgctggttgaggattgtcgatttcagttcgatttcgtttttgtagaggaggcattgat |
91 |
Q |
| |
|
||||||||||| | |||| ||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
6887594 |
attgtgattgcagattgaagattgtcgatttcagatcgatttcgtttctgtagaggaggcattgat |
6887529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University