View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17949_high_7 (Length: 321)
Name: NF17949_high_7
Description: NF17949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17949_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 11 - 156
Target Start/End: Complemental strand, 10245336 - 10245191
Alignment:
| Q |
11 |
ttatacttccttcctttgacttattttttctatttgccttttaatcttcataaaagtttaatactcactcaatattttacattttttattggttctggaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10245336 |
ttatacttccttcctttgacttattttttctatttgccttttaatcttcataaaagtttaatactcactcaatattttacattttttattggttctggaa |
10245237 |
T |
 |
| Q |
111 |
ttttctcttgctagtaattttttccttctagatgaacttgatttga |
156 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
10245236 |
ttttctcttgctagtaatttttttcttctacatgaacttgatttga |
10245191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 229 - 305
Target Start/End: Complemental strand, 10245119 - 10245043
Alignment:
| Q |
229 |
tttcttctccactagccaactctgttgttttctatcactgtctaatgtttttctaaattgtcctttgctttgttctt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10245119 |
tttcttctccactagccaactctgttgttttctatcactgtctaatgtttttctaaattgtcctttgctttgttctt |
10245043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University