View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1794_high_10 (Length: 219)
Name: NF1794_high_10
Description: NF1794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1794_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 109 - 210
Target Start/End: Complemental strand, 35177338 - 35177237
Alignment:
| Q |
109 |
acaagtatggtttggaaggacaggtggctgttaatgacctgtttcattataatactaacaaaatctttaagtcatattttaatgtcaaatattggatctc |
208 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35177338 |
acaagtatgatttggaagaacaggtggctgttaataacctgtttcattataatactaacaaaatctttaagtcatattttaatgtcaaatattggatctc |
35177239 |
T |
 |
| Q |
209 |
tg |
210 |
Q |
| |
|
|| |
|
|
| T |
35177238 |
tg |
35177237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 109 - 210
Target Start/End: Complemental strand, 42910049 - 42909950
Alignment:
| Q |
109 |
acaagtatggtttggaaggacaggtggctgttaatgacctgtttcattataatactaacaaaatctttaagtcatattttaatgtcaaatattggatctc |
208 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||| |||||| ||| |||||||||||||||||||||| ||| || |
|
|
| T |
42910049 |
acaagtatggtttggaaggacaggtggatgttcttgacctgtttcattataatagtaa-aaaatc-ctaaatcatattttaatgtcaaatattagatgtc |
42909952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 52 - 96
Target Start/End: Original strand, 52544335 - 52544379
Alignment:
| Q |
52 |
cttaattaacaagctactacaacctttaatcaaccaatccttaga |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52544335 |
cttaattaacaagctactacaacctttaatcaaccaatccttaga |
52544379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University