View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1794_low_9 (Length: 249)
Name: NF1794_low_9
Description: NF1794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1794_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 214
Target Start/End: Original strand, 9092866 - 9093068
Alignment:
| Q |
12 |
atgaatgatggtctgcgcatgatgaaaacattgcacaaaaaataatgaagacttattaaagaagaagcactctcaccacgtggttttttgtaaatttcgt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9092866 |
atgaatgatggtctgcgcatgatgaaaacattgcacaaaaaataatgaagactgattaaagaagaagcactctcaccacgtggttttgtgtaaatttcgt |
9092965 |
T |
 |
| Q |
112 |
gcagtcttcgtttgtaacattaaaaataaaagcaaagctttttcttaatctaatatacaagctgtaatacattgtatataaaacaataggttgcttataa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9092966 |
gcagtcttcgtttgtaacattaaaaataaaagcaaagctttttcttaatctaatatacaagctgtaatatattgtatataaaacaataggttgcttataa |
9093065 |
T |
 |
| Q |
212 |
cat |
214 |
Q |
| |
|
||| |
|
|
| T |
9093066 |
cat |
9093068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University