View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17952_high_23 (Length: 273)
Name: NF17952_high_23
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17952_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 266
Target Start/End: Complemental strand, 35426088 - 35425839
Alignment:
| Q |
19 |
taatgttttacatct-ctctacattgaaaatattgtagtttctctgannnnnnnnnnn-agaatttaaaatttgatttctaatcttgtcttgatgttata |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35426088 |
taatgttttacatcttctctacattgaaaatattgtagtttctctgattttttttttttagaatttaaaatttgatttctaatcttgtcttgatgttata |
35425989 |
T |
 |
| Q |
117 |
catacaatgatgcacatctttaatcttgtctagaaagttaaattgttctgcataatgaagactgaatgcttgctaaatgctgacattctctgacaaaagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35425988 |
catacaatgatgcacatctttaatcttgtctagaaagttaaattgttctgcataatgaagactgaatgcttgctaaatgttgacattctctgacaaaagg |
35425889 |
T |
 |
| Q |
217 |
aggaccaggtctccacatctgttttcttgcaaatacaatgtcctttgctt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35425888 |
aggaccaggtctccacatctgttttcttgcaaatacaatgtcctttgctt |
35425839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University