View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17952_high_25 (Length: 262)
Name: NF17952_high_25
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17952_high_25 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 22 - 262
Target Start/End: Original strand, 42018081 - 42018320
Alignment:
| Q |
22 |
agctgctgccaagaaaacggaaactcttccattttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaagctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018081 |
agctgctgccaagaaaacggaaactcttcc-ttttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaagctt |
42018179 |
T |
|
| Q |
122 |
tcagctgataataataagagcagcaaggcggcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggcttgacg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018180 |
tcagctgataataataagagcagcaaggcggcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggcttgacg |
42018279 |
T |
|
| Q |
222 |
gctgggatcaagaagatacttatgctgctcttgctgttgtc |
262 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42018280 |
gctgggaacaagaagatacttatgctgctcttgctgttgtc |
42018320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 262
Target Start/End: Original strand, 1251297 - 1251540
Alignment:
| Q |
18 |
agtcagctgctgccaagaaaacggaaactcttccattttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251297 |
agtcagctgctgccaagaaaacggaaactattcc-ttttgtcagagtcaggtgtcagtggatgagagaatgagctccgatgtcatcgagactgaagcaaa |
1251395 |
T |
|
| Q |
118 |
gctttcagctgataataataagagcagcaaggcggcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251396 |
gctttcagctgataataataagagcagcaaggcgtcggtttctcgaatcaacagcgggaaaggagcttcatgcaggtctcgttctatgacatcatggctt |
1251495 |
T |
|
| Q |
218 |
gacggctgggatcaagaagatacttatgctgctcttgctgttgtc |
262 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1251496 |
gacggctgggaacaagaagatacttatgctgctcttgctgttgtc |
1251540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University