View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17952_high_29 (Length: 244)
Name: NF17952_high_29
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17952_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 229
Target Start/End: Complemental strand, 329988 - 329776
Alignment:
| Q |
17 |
agatattgtatgtttgctgcttcgaattgtatgtatatttttcactactcgtactaacttgtttgcgtttgtatattggtgcagttgtgctgctctctgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329988 |
agatattgtatgtttgctgcttcgaattgtatatatatttttcaccactcgtactaacttgtttgcgtttgtatattggtgcagttgtgctgctctctgc |
329889 |
T |
|
| Q |
117 |
tgttgctgcctattagatgcctgcttctaagaagactttactctgcactaataggattgaagtgtgtttaagcattgagctcaatgaaaattgtttcatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329888 |
tgttgctgcctattagatgcctgcttctaagaagactttactctgcactaataggattgaagtgtgtttaagcattgagctcaatgaaaattgtttcatg |
329789 |
T |
|
| Q |
217 |
tttcttttctgtg |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
329788 |
tttcttttctgtg |
329776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 164
Target Start/End: Original strand, 48030582 - 48030662
Alignment:
| Q |
84 |
tttgtatattggtgcagttgtgctgctctctgctgttgctgcctattagatgcctgcttctaagaagactttactctgcac |
164 |
Q |
| |
|
|||||| |||| ||||| | |||||||||||||||||||| || || ||||| ||||| | ||||||| ||||| ||||| |
|
|
| T |
48030582 |
tttgtaaattgttgcagcttggctgctctctgctgttgctgtctcttggatgcatgcttttgagaagacattactttgcac |
48030662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University