View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17952_low_18 (Length: 329)
Name: NF17952_low_18
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17952_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 14 - 312
Target Start/End: Complemental strand, 12033655 - 12033357
Alignment:
| Q |
14 |
ttcttgtactttgctactaatgtgtcaatttgtgatcttatttgctaattgctaattatcttaattgtatttaccgaatcaaattcaacattgtatatgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
12033655 |
ttcttgtactttgctactaatgtgtcaatttgtgatcttatttgctaattgctaattatcttaattctatttaccgattcaaattcaacattgtatatgt |
12033556 |
T |
|
| Q |
114 |
atctggttcaac-tcagtgtttacagatcaatttccattagaggctcatttctaatataaaagcggggtctccgttttgatataaacgaccttgacccag |
212 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12033555 |
atctggttcaacttcaatgttgacagatcaattgccattagaggctcatttctaatataaaagcggggtctccgttttgatataaacgaccttgatccag |
12033456 |
T |
|
| Q |
213 |
tgatgaaaaataagttttagactacatgagagaggctgagtgtaactcttgtagtcacaagaatacacttcgcaatgttgtgtttacgatgattggtttt |
312 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12033455 |
tgatg-aaaataagttttagactacatcagagaggctgagtgtaactcttgtagtcacaaggacacacttcgcaatgttgtgtttacgatgattggtttt |
12033357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University