View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17952_low_20 (Length: 309)
Name: NF17952_low_20
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17952_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 11174068 - 11173975
Alignment:
| Q |
18 |
gtttaatatcgtgaatgtttgcataatattgcaaacaatgtggcgccaatttgtatattttgtggtaaacgacttgcataatc-ttggttgagc |
110 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11174068 |
gtttaatatcatgaatgtttgcatgatattgcaaacaatgtggcgccaatttgtatattttgtggtaaacgacttgcataatctttggttgagc |
11173975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 227 - 302
Target Start/End: Complemental strand, 11173842 - 11173767
Alignment:
| Q |
227 |
gacggaaatggatcgtctcaattgtacttcacttgtcttttctcaaattataatcacaaccattacgattcttctc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11173842 |
gacggaaatggatcgtctcaattgtacttcacttgtcttttctcaaattataatcacaaccattacgattcttctc |
11173767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University