View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17952_low_21 (Length: 301)
Name: NF17952_low_21
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17952_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 2446450 - 2446741
Alignment:
| Q |
18 |
tgtgcgtggaaattggaatgattgaaagagtaaaatatgagtaatgtaagcatgtg------attgagaagctaaatctaaatccaaagcatagcgttca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2446450 |
tgtgcgtggaaattggaatgattgaaagagtaaaatatgagtaatgtaagcatgtgattgtgattgagaagctaaatctaaatccaaagcatagcgttca |
2446549 |
T |
 |
| Q |
112 |
ttttcattcattcatttattatcaattaatcaatcaatagtatattaataattctctaccttcactccactctcaaacttcaaagac-----aacataac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2446550 |
ttttcattcattcatttattatcaattaatcaatcaatagtatattaataattctctaccttcactccactctcaaacttcaaagacaacataacataac |
2446649 |
T |
 |
| Q |
207 |
acagtcaacaagtttggttccttattatcatcaaaacaatatcatgggacaaatcttcgataaattacaaggttattttctttctttctttc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2446650 |
acagtcaacaagtttggttccttattatcatcaaaacaatatcatgggacaaatcttcgataaattacaaggttattttctttctttctttc |
2446741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University