View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17952_low_24 (Length: 293)
Name: NF17952_low_24
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17952_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 121 - 276
Target Start/End: Original strand, 4283814 - 4283969
Alignment:
| Q |
121 |
atataattgtaacatctgtcttttaatgctgttgagtggagcggtaacatggtgtcatatttgtatcaaattgacggacaatatattgaatgaccaaatt |
220 |
Q |
| |
|
||||| ||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4283814 |
atatagttgcaacatctgtctttttattttgttgagtggagcggtaacatggtgtcatatttgtatcaaattgacggacaatatattgaatgaccaaatt |
4283913 |
T |
 |
| Q |
221 |
aattaatactactgttagtaagttgtcaaattgagtatagtaaataactttggcag |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4283914 |
aattaatactactgttagtaagttgtcaaattgagtatagtaaataactttggcag |
4283969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University