View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17952_low_29 (Length: 248)
Name: NF17952_low_29
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17952_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 33648211 - 33647976
Alignment:
| Q |
1 |
ttatgttcaagttgaaggacaactagtcccaacaacaacagaagtaacttctcataaaaatccctcaaatcctcactatactcttactatttactatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33648211 |
ttatgttcaagttgaaggacaactagtcccaacaacaacagaagtaacttctcagaaaaatccctcaaatcctcactatactcttactatttactatttt |
33648112 |
T |
 |
| Q |
101 |
gttttcaagtaaacaaacaaaaaacgttttactcacttttcttccttactactac------tactccatgatactaataattagttcttctttttacctt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33648111 |
gttttcaagtaaacaaacaaaaaacgttttactcacttttcttccttactactactactactactccatgatactaataattagttcttctttttacctt |
33648012 |
T |
 |
| Q |
195 |
actcaatttcatccatcttcttgttttcttgctatt |
230 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33648011 |
actcaatttcatccatcttcttgttctcttgctatt |
33647976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University