View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17952_low_30 (Length: 245)
Name: NF17952_low_30
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17952_low_30 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 245
Target Start/End: Original strand, 25895519 - 25895750
Alignment:
| Q |
15 |
catcatcacctgcccctcctataacttcccctacagatcagaatttcccatctcccaactctcaatcaacccatcatctgtcctcttcta-aaatccact |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25895519 |
catcatcagctgcccctcctataacttcccctacagatcagaatttcccatctcccaactctcaatcaacccatcatctgtcctcttctacaaatccact |
25895618 |
T |
 |
| Q |
114 |
tccttccacaacttcctcaataaatcaacccacatctacacctatttccttttctgccacccacttaacttcacccaatgcatccctgccccttactact |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25895619 |
tccttccacaacttcctctataaatcaacccacatctacacatatttccttttctgccacccacttaacttcacccaatgcatccctgccccttactact |
25895718 |
T |
 |
| Q |
214 |
tctgctccccccacacctccaccaccagttaa |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25895719 |
tctgctccccccacacctccaccaccagttaa |
25895750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University