View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17952_low_37 (Length: 210)
Name: NF17952_low_37
Description: NF17952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17952_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 39600915 - 39601129
Alignment:
| Q |
1 |
cttcaagtgctggtggtggtggtgtttccgggtgttggcatggtagcgagagtgaaagtgtacgtccccatattgtccattcgggtggagattgatcaag |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39600915 |
cttcaagtggcggtggtggtggtgtttccgggtgttggtatggtagcgagagtgaaagtgtacgtccccatattgtccattcgggtggagattgatcaag |
39601014 |
T |
 |
| Q |
101 |
tgt------cggcggcggcatggttggtggtgtttccggttgttggtatggccatgcaagtgaaagtgtacgcccccatgctctatgaatatctcttatg |
194 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39601015 |
tgtcggtggcggcggcggcatggttggtggtgtttccggttgttggtatggcggtgcaagtgaaagtgtacgcccccatgctctatgaatatctcttaag |
39601114 |
T |
 |
| Q |
195 |
ttttccattcatttc |
209 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
39601115 |
ttttccattcttttc |
39601129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University