View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17954_high_29 (Length: 208)
Name: NF17954_high_29
Description: NF17954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17954_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 14 - 97
Target Start/End: Original strand, 7576127 - 7576206
Alignment:
| Q |
14 |
tgagatgaaatgatgtacctgttgacttttttatcaactgatagatagaagtgaacgttcctcgcgaactgcgtgggcaataaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7576127 |
tgagatgaaatgatgtacctgttgactttgttatcaact----gatagaagtgaacgctcctcgcgaactgcgtgggcaataaa |
7576206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 94 - 156
Target Start/End: Original strand, 7588182 - 7588244
Alignment:
| Q |
94 |
taaagtattcaacacaaatttctaattccaaacaaaaacctataaaaacatttctttctcttt |
156 |
Q |
| |
|
|||| ||||||| |||||||||||||||| || ||| ||| |||||||||| |||||||||| |
|
|
| T |
7588182 |
taaaatattcaaaacaaatttctaattcccaaaaaacccctgtaaaaacattgctttctcttt |
7588244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University