View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17955_high_15 (Length: 235)

Name: NF17955_high_15
Description: NF17955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17955_high_15
NF17955_high_15
[»] chr5 (1 HSPs)
chr5 (1-221)||(42284037-42284256)


Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 42284256 - 42284037
Alignment:
1 tgagaacccgagagaacataatggattaaagtcgttaaaccatcaatagttcaaatcataagtgaagnnnnnnnaacttagccttgatctataaccaaat 100  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||    
42284256 tgagaacccgagagaacctaatggattaaagtcgttaaaccatcaatagttcaaatcataagtgaagtttttt-aacttagccttgatctataaccaaat 42284158  T
101 ttgatttgtagcatgatccatgatttgatctataaccaaacaccttaaacatggagaagtagaaaattgtgaacttgaacttgcccctaacacatcaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42284157 ttgatttgtagcatgatccatgatttgatctataaccaaacaccttaaacatggagaagtagaaaattgtgaacttgaacttgcccctaacacatcaaat 42284058  T
201 gtccatgtagttgccaacagt 221  Q
    |||||||||||||||||||||    
42284057 gtccatgtagttgccaacagt 42284037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University