View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17955_low_16 (Length: 242)
Name: NF17955_low_16
Description: NF17955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17955_low_16 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 10 - 242
Target Start/End: Original strand, 38475959 - 38476193
Alignment:
| Q |
10 |
tgagaagaacaaaactttgtgcaaacgcaaagatgataattgtagaaaatttgttattgatggattgttgagtcttggatatgatgcttcaatttgcaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38475959 |
tgagaagaacaaaactttgtgcaaacgcaaagatgataattgtagaaaatttgttattgatggattgttgagtcttggatatgatgcttcaatttgcaaa |
38476058 |
T |
|
| Q |
110 |
tctcgctgggaaaaatccactttctgtatagccggtaatttctc-taactatgaaaaattcttatcaaacacttttgatcaaagacgtgtcta-ttgtcg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
38476059 |
tctcgctgggaaaaatccactttctgtatagccggtaatttctcttaactatgaaaaattcttatcaaacacttttgatcaaagacgtgtccagttgtcg |
38476158 |
T |
|
| Q |
208 |
gtgtctctctgatactcaaattttaattttttagg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38476159 |
gtgtctctctgatactcaaattttaattttttagg |
38476193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University