View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17955_low_19 (Length: 201)
Name: NF17955_low_19
Description: NF17955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17955_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 14 - 179
Target Start/End: Original strand, 31734480 - 31734655
Alignment:
| Q |
14 |
aagaatattgacattaataaaacactcaatttatcgtctttataagtagatatgtgggtgaaaatcaaacatatgcatatagtgg------------gta |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31734480 |
aagaatattgacattaataaaacactcaatttatcgtctttataagtagatatgtgggtgaaaatcaaacatatgcatatagtgggtttttagcattgta |
31734579 |
T |
 |
| Q |
102 |
caatgcacatatcccacctgcaaaagaacgtgggagccatatatatatcattcattcataacatctctatgtcatgtc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31734580 |
caatgcacatatcccacctgcaaaagaacgtgggagcc--atatatatcattcattcataacatctctatgtcatgtc |
31734655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University