View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17956_high_16 (Length: 318)
Name: NF17956_high_16
Description: NF17956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17956_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 4089892 - 4090152
Alignment:
| Q |
1 |
gtggtcaaattcatcactcatcagcagaggtaataattctctttaatatcatcgatggatgtttgatcaaatatataaatgctttcttggtttatttaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4089892 |
gtggtcaaattcatcactcatcagcagaggtaataattctctttaatatcatcgatggatgtttgatcaaatatataaatgctttcttggtttatt-aag |
4089990 |
T |
 |
| Q |
101 |
tgttagggttgtgttgcgtataatatctgcgtggcaccaacacttttgattgaaggtatgttccggtgtccaacatgtgtcagtgtctgacacaacaccg |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4089991 |
tgttagggttgcgttgcgtataatatctgcgtggcaccaacacttttgattgaaggtatgttccggtgtccaacatgtgtcagtgtctgacacaacaccg |
4090090 |
T |
 |
| Q |
201 |
gcacaagtgattgctttgagttatgtcattttctcaaaattttactggggtcaacatctcaa |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4090091 |
gcacaagtgattgctttgagttatgtcattttctcaaaattttaccggggtcaacatctcaa |
4090152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 134 - 238
Target Start/End: Complemental strand, 7942373 - 7942269
Alignment:
| Q |
134 |
gcaccaacacttttgattgaaggtatgttccggtgtccaacatgtgtcagtgtctgacacaacaccggcacaagtgattgctttgagttatgtcattttc |
233 |
Q |
| |
|
|||||||||||| |||| ||||| ||| ||||||| ||| ||||||||||| |||||| ||| | |||| |||||| | |||| |||||||||| || |
|
|
| T |
7942373 |
gcaccaacacttctgatctaaggtgtgtcgtggtgtccgacacgtgtcagtgtccgacacagcactgacacatgtgattacattgaattatgtcattgtc |
7942274 |
T |
 |
| Q |
234 |
tcaaa |
238 |
Q |
| |
|
||||| |
|
|
| T |
7942273 |
tcaaa |
7942269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 199
Target Start/End: Original strand, 29651731 - 29651764
Alignment:
| Q |
166 |
gtgtccaacatgtgtcagtgtctgacacaacacc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
29651731 |
gtgtccaacatgtgtcagtgtctgacacgacacc |
29651764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University