View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17956_low_19 (Length: 283)
Name: NF17956_low_19
Description: NF17956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17956_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 270
Target Start/End: Complemental strand, 35004574 - 35004322
Alignment:
| Q |
18 |
caaacgtggtacaagatgaaccttcaccaaacaattggccggtaaatgnnnnnnnttattcatgacattttgtatcattgccatataaggagtaattttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |||| ||||||||||||||| |
|
|
| T |
35004574 |
caaacgtggtacaagatgaaccttcaccaaacaattggccggtaaatgaaaaaaattattcatggcattttgtttcattaccatgtaaggagtaattttc |
35004475 |
T |
 |
| Q |
118 |
acaatgtttgtgtcatttgtacttcaaaacgcgacattgtatgtgaggcacatacatgtttttctctatctttcattcactttttatcttctacaactta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35004474 |
acaatgtttgtgtcatttgtacttcaaaacgcgacattgtatgtgaggcacatacatgtttttctctatctttcattcactttttatattctacaactta |
35004375 |
T |
 |
| Q |
218 |
cttgcatttcaaaaataaacacatttagattgtgatgctagttttcctctgat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004374 |
cttgcatttcaaaaataaacacatttagattgtgatgctagttttcctctgat |
35004322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University