View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17956_low_26 (Length: 219)
Name: NF17956_low_26
Description: NF17956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17956_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 76 - 200
Target Start/End: Original strand, 52753355 - 52753479
Alignment:
| Q |
76 |
ctaaacaggagagagtagcatagcattacatacgaaacctacggtatttgtttgactggctatacatgacatgtaggtctctttgatctttcacgaacaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52753355 |
ctaaacaggagagagtagcatagcattacatacgaaacctatggtatttgtttgactggctatatatgacatgtaggtctctttgatctttcacgaacaa |
52753454 |
T |
 |
| Q |
176 |
gaaggaatgcacgatacatcggata |
200 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52753455 |
gaaggaatgcacgatacatcggata |
52753479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University