View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17956_low_28 (Length: 202)
Name: NF17956_low_28
Description: NF17956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17956_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 8e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 35520879 - 35520945
Alignment:
| Q |
1 |
atatactttttggttatatttcatcgtagtaattcttagcattgaattatcttccgttgccttgaat |
67 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35520879 |
atatacttattggttatatttcatcgtaataattcttagcattgagttatcttccgttgccttgaat |
35520945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 35520944 - 35521004
Alignment:
| Q |
100 |
atattatacttttcaacttatcacgttcctcttgtcnnnnnnntaaattcattatctataa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35520944 |
atattatacttttcaacttatcacgttcctcttgtcaaaaaaataaattcattatctataa |
35521004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University