View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17957_low_3 (Length: 233)
Name: NF17957_low_3
Description: NF17957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17957_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 21 - 216
Target Start/End: Complemental strand, 40206551 - 40206356
Alignment:
| Q |
21 |
gtatgttactttgttgttgtgctttctctcatgttcaaactactgcttccttttttcttttggcatcatagaattagataaaaataaaacaagctttcct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40206551 |
gtatgttactttgttgttgtgctttctctcatgttcaaactactgcttccttttttcttttggcatcatagaattagataaaaataaaacaagctttcct |
40206452 |
T |
 |
| Q |
121 |
ttgttttcaagaatctacactagttttgctggtgaattatagaaaaatttggcatgcttgttgtggttgatatttgtgttttgttattgggataga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40206451 |
ttgttttcaagaatctacactagttttgctggtgaattatagaaaaatttggcatgcttgttgtggttgatatttgtgttttgttattgggataga |
40206356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 64
Target Start/End: Complemental strand, 40207366 - 40207332
Alignment:
| Q |
30 |
tttgttgttgtgctttctctcatgttcaaactact |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40207366 |
tttgttgttgtgctttctctcatgttcaaactact |
40207332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 40207085 - 40207041
Alignment:
| Q |
162 |
gaaaaatttggcatgcttgttgtggttgatatttgtgttttgtta |
206 |
Q |
| |
|
|||||||| | |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
40207085 |
gaaaaattggacatgtttgttgtggttgatacttgtgttttgtta |
40207041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University