View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17959_high_14 (Length: 351)
Name: NF17959_high_14
Description: NF17959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17959_high_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 14 - 351
Target Start/End: Complemental strand, 28924222 - 28923882
Alignment:
| Q |
14 |
cagagacggtggtgactgttcgtaatgtgctgggaagatggagcaggaaggtgggagaggcaactaagaaggctgagactctcgctggaaatacttggca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28924222 |
cagagacggtggtgactgttcgtaatgtgctgggaagatggagcaggaaggtgggagaggcaactaagaaggctgagactctcgctggaaatacttggca |
28924123 |
T |
 |
| Q |
114 |
acattgtacgttttctgttcatcttatggtcttggttcgtcgt---aatgtgtttagttatcaagtaggtgcaggttgaattttacattggaataaccaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28924122 |
acattgtacgttttctgttcatcttatgttcttggttcgtcgtcgtaatgtgtttagttatcaagtaggtgcaagttgaattttacattggaataaccaa |
28924023 |
T |
 |
| Q |
211 |
tttagaaactaatttttagagttatataaatttaagtacgattgagattgttatatgtatttgtcagaaatgtgcattttgtgattaagacccgcattgt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28924022 |
tttagaaactaatttttagagttatataaatttaagtacgattgagattgttatatgtatttgtcagaaatgtgcattttgtgattaagacccgcattgt |
28923923 |
T |
 |
| Q |
311 |
ggttcatcgttttatgggaattagctgtttttctagactca |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28923922 |
ggttcatcgttttatgggaattagctgtttttctagactca |
28923882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University