View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17959_high_27 (Length: 281)
Name: NF17959_high_27
Description: NF17959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17959_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 15 - 274
Target Start/End: Original strand, 22041603 - 22041862
Alignment:
| Q |
15 |
acttgtgcctaatgttcttgctggaattgggtatgctttgtcatctactgtgaatgttcattttgtgagaatgttggattgtttgtttggaatttgggga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22041603 |
acttgtgcctaatgttcttgctggaattgggtatgctttgtcatcttctgtgaatgttcattttgtgagaatgttggattgtttgtttggaatttgggga |
22041702 |
T |
|
| Q |
115 |
aagggtgatggtgggcctcaaggtcgtgttgttcatggacttatggttctttatttgtttgattgggttgcgtcgaatttgatcaatttcagatatttgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22041703 |
aagggtgatggtgggcctcaaggtcgtgttgttcatggacttatggttctttatttgtttgattgggttgcgtcgaatttgatcaatttcagatttttgg |
22041802 |
T |
|
| Q |
215 |
acaaagtggatgtttttgtgagagttttaaggaaaactatgcaccatttgttgttttcat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22041803 |
acaaagtggatgtttttgtgagagttttaaggaaaactatgcaccatttgttgttttcat |
22041862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 2425826 - 2425603
Alignment:
| Q |
15 |
acttgtgcctaatgttcttgctggaattgggtatgctttgtcatctactgtgaatgttcattttgtgagaatgttggattgtttgtttggaatttgggga |
114 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| || |||||||||||| |||||||||| |
|
|
| T |
2425826 |
acttgtgcctaacgttcttgctggaattgggtatgctttgtcatcttctgtgaatgttcattttgttagaatcttcgattgtttgtttaaaatttgggga |
2425727 |
T |
|
| Q |
115 |
aagggtgatggtgggcctcaaggtcgtgttgttcatggacttatggttctttatttgtttgattgggttgcgtcgaatttgatcaatttcagatatttgg |
214 |
Q |
| |
|
|| | ||||| |||||||| |||| ||| |||||||||||| ||||||||||||||||| |||||| ||||||| ||||||||||||||| | | ||||| |
|
|
| T |
2425726 |
aaagatgatgatgggcctcgaggtagtgctgttcatggactcatggttctttatttgttcgattggattgcgtctaatttgatcaatttcgggtttttgg |
2425627 |
T |
|
| Q |
215 |
acaaagtggatgtttttgtgagag |
238 |
Q |
| |
|
| |||||| |||||| ||||||| |
|
|
| T |
2425626 |
ataaagtgagtgttttggtgagag |
2425603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University