View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17959_high_47 (Length: 226)
Name: NF17959_high_47
Description: NF17959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17959_high_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 100 - 212
Target Start/End: Complemental strand, 15323011 - 15322899
Alignment:
| Q |
100 |
tatgctgcatcaaattccatgaactttagatgaaggcatgcagcttgattgctattattcttttaatgttaaataggatgcaactgttcctttgataatt |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15323011 |
tatgcttcatcaaattccatgaactttagatcaaggcatgcagcttgattgctattatgcttttaatgttaaataggatgcaactgttcctttgataatt |
15322912 |
T |
|
| Q |
200 |
ttttcttgttctt |
212 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15322911 |
ttttcttgttctt |
15322899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 21 - 98
Target Start/End: Complemental strand, 15323124 - 15323047
Alignment:
| Q |
21 |
catgcttcatagaattctactaataataagagcgaaagaagacatggcaacatgggtaactgtgaccaatgaaagctt |
98 |
Q |
| |
|
||||||| ||||||| | | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15323124 |
catgctttatagaataccagtaataataagagcgaaagaagacatggcaagatgggtaactgtgaccaatgaaagctt |
15323047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 15313005 - 15312944
Alignment:
| Q |
152 |
tattattcttttaa-tgttaaataggatgcaactgttcctttgataattttttcttgttctt |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
15313005 |
tattattcttttaaatgttaaataggatgcaactgtttctttaatacttttttcttgttctt |
15312944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University