View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17959_low_12 (Length: 370)
Name: NF17959_low_12
Description: NF17959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17959_low_12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 114 - 370
Target Start/End: Complemental strand, 45379348 - 45379091
Alignment:
| Q |
114 |
tataacttatcttgaaagtgatattttttgagacacggcaacacttctctcaattgaatgcgatatttattcgccacactaaaatgttaacacttctctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45379348 |
tataacttatcttgaaagtgatattttttgagacacggcaacacttctctcaattgaatgcgatatttattcgccacactaaaatgttaacacttctctc |
45379249 |
T |
 |
| Q |
214 |
aactgaatgcgatatttaattcaccaagttattagagtttataaatatttagtaagactcaaaactccctttgtaaaaataatgttataatttatgccaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45379248 |
aactgaatgcgatatttaattcaccaagttattagagtttataaatatttagcaagactcaaaactccctttgtaaaaataatgttataatttatgccaa |
45379149 |
T |
 |
| Q |
314 |
acgaacaagg-nnnnnnncacaggtgtctggcattgtccatgcaactacgtacaagcc |
370 |
Q |
| |
|
|||||||||| |||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
45379148 |
acgaacaaggaaaaaaaacacagggttctggcagtgtccatgcaactacgtacaagcc |
45379091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University