View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17959_low_27 (Length: 283)
Name: NF17959_low_27
Description: NF17959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17959_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 26 - 168
Target Start/End: Complemental strand, 8169975 - 8169833
Alignment:
| Q |
26 |
gtagagtatctcgatgatgctggaatctaagatcttgtcttaattttcctattaatcaaattaattaatctactaatccaagttttttcccgaaagtatc |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
8169975 |
gtagagtatctcgatgatgctggaatctaagatctgatctgaattttcctattaatcaaattaattaatctagtaatccaagttttttccggaaagtatc |
8169876 |
T |
|
| Q |
126 |
taatgatctaagctaacacgatttaaataatttcatttgacac |
168 |
Q |
| |
|
|| |||| |||||||| | || ||||||||||||||||||| |
|
|
| T |
8169875 |
tagtgatttaagctaaaataatgcaaataatttcatttgacac |
8169833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University