View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17959_low_30 (Length: 277)
Name: NF17959_low_30
Description: NF17959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17959_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 9 - 272
Target Start/End: Original strand, 45378892 - 45379133
Alignment:
| Q |
9 |
cttgttatattattggttttgattctttattgcagctaataacattaatatcgactttgtgacattactctcggtcaaattttaaggtagtcttgtcttg |
108 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45378892 |
cttgttatattattggttttgattgtttattgcagctaataatattaatatcgactttgtgacattactctcggtcaaattttaaggtagtcttgtcttg |
45378991 |
T |
 |
| Q |
109 |
gagtggtttctggcaaaatgtaaccgtgtctgtcagtatgttttttgtctggttggccaagggggaatggaattttacttgcaaagtgttgatcaatttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45378992 |
gagtggtttctggcaaaatgtaaccgtgtc-----------------tctggttggccaaggg-----ggaattttacttgcaaagtgttgatcaatttt |
45379069 |
T |
 |
| Q |
209 |
atatccccattggttacagttggcttgtacgtagttgcatggacactgccagaaccctatgttt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45379070 |
atatccccattggttacagttggcttgtacgtagttgcatggacactgccagaaccctgtgttt |
45379133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University