View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17959_low_40 (Length: 240)

Name: NF17959_low_40
Description: NF17959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17959_low_40
NF17959_low_40
[»] chr5 (1 HSPs)
chr5 (1-223)||(14056671-14056887)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 14056887 - 14056671
Alignment:
1 agaattttcggggcatccttataattaaaaaatatagtttaggggcaccaccatgcaaatatcataaatttacacatggtggtggtcatgatgcaaggga 100  Q
    |||||||||||||||||||||      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
14056887 agaattttcggggcatcctta------aaaaatatagtttaggggcaccaccatgcaaatatcataaatttacacatggtggtggtcatgatgcaatgga 14056794  T
101 tgggcgtggatgaggaatttgattacctgcaagaactgaatagtcacctgttaggggaataccttccgtttagatgtaacttgaatactagtggaacgag 200  Q
    ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
14056793 tgggcgtggatgaggaatttgattacacgcaagaactgaatagtcacctgttaggggaataccttccgtttagatgtaagttgaatactagtggaacgag 14056694  T
201 catttgactttgtcactccaaat 223  Q
    |||||||||||||||||||||||    
14056693 catttgactttgtcactccaaat 14056671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University