View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1795_high_3 (Length: 325)
Name: NF1795_high_3
Description: NF1795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1795_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 6e-62; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 31 - 159
Target Start/End: Complemental strand, 7682938 - 7682810
Alignment:
| Q |
31 |
aaatgccccctttgttatgcattccctcaccttttctctttttctactaaaaaagaggctctggtgggggacctttgggccttgacagacggtgtggggg |
130 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7682938 |
aaatgccccctttgtgatgcattccctcaccttttctctttttctactaaaaaaaaggctctggtgggggacctttgggccttgacagacggtgtggggg |
7682839 |
T |
|
| Q |
131 |
gatggtcgtttgtttggaggagataacct |
159 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7682838 |
gatggtcgtttgtttggaggagataacct |
7682810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 195 - 257
Target Start/End: Complemental strand, 7682811 - 7682749
Alignment:
| Q |
195 |
ctattcaagggtttagaggaggggtggaggaggatgtttggtagtggatttcagatgaggatg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7682811 |
ctattcaagggtttagaggaggggtggaggaggatgcttggtagtggatttcagatgaggatg |
7682749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 16196117 - 16196356
Alignment:
| Q |
20 |
aaatgggttggaaatgccccc--tttgttatgcattccctcaccttttctctttttctactaaaaaagaggctctggtgggggacctttgggccttgaca |
117 |
Q |
| |
|
|||||||||||||| ||||| ||||| | |||||||||| | |||||||| ||||||||||| ||||||||| |||||| ||||| || ||| ||| |
|
|
| T |
16196117 |
aaatgggttggaaactccccccatttgtgaggcattccctctcattttctctctttctactaaataagaggctccagtggggagccttttggtcttaaca |
16196216 |
T |
|
| Q |
118 |
ga--------cggtgtggggggatggtcgtttgtttggaggagataacctttcaattggggaaaggattta---aa--agttgttagatactattcaagg |
204 |
Q |
| |
|
|| || | |||||||| ||||||||||| | |||||| ||||||||| |||| | |||| ||| || ||| ||| | ||| ||||||| |
|
|
| T |
16196217 |
gaggttggggggggggggggggattgtcgtttgtttaggggagattacctttcaaatgggaagaggacttacttaatgagtggtttgtcactcttcaagg |
16196316 |
T |
|
| Q |
205 |
gtttagaggaggggtggaggaggatgtttggtagtggatt |
244 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||| |
|
|
| T |
16196317 |
gtttagaggaggggtggatgaggatgcttggcggtggatt |
16196356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University