View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1795_high_4 (Length: 210)

Name: NF1795_high_4
Description: NF1795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1795_high_4
NF1795_high_4
[»] chr2 (1 HSPs)
chr2 (17-165)||(26049895-26050044)


Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 165
Target Start/End: Original strand, 26049895 - 26050044
Alignment:
17 caaaggcaggtacgacgagttggcaattgcacttcttgataaggtgttgctaatttgatatggatttgaatcttctggttttaacacttgacatgacttt 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
26049895 caaaggcaggtacgacgagttggcaattgcacttcttgataaggtgttgctaatttgatatggatttgaatcttctggttttaacactggacatgacttt 26049994  T
117 tgctgcattggtgggttctgattctatatt-cgacaaccagggagaattc 165  Q
    |||||||||||||||||||||| ||||||| |||||||||||||||||||    
26049995 tgctgcattggtgggttctgatcctatattccgacaaccagggagaattc 26050044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University