View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1795_low_8 (Length: 210)
Name: NF1795_low_8
Description: NF1795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1795_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 165
Target Start/End: Original strand, 26049895 - 26050044
Alignment:
| Q |
17 |
caaaggcaggtacgacgagttggcaattgcacttcttgataaggtgttgctaatttgatatggatttgaatcttctggttttaacacttgacatgacttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26049895 |
caaaggcaggtacgacgagttggcaattgcacttcttgataaggtgttgctaatttgatatggatttgaatcttctggttttaacactggacatgacttt |
26049994 |
T |
|
| Q |
117 |
tgctgcattggtgggttctgattctatatt-cgacaaccagggagaattc |
165 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
26049995 |
tgctgcattggtgggttctgatcctatattccgacaaccagggagaattc |
26050044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University