View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17961_high_24 (Length: 262)
Name: NF17961_high_24
Description: NF17961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17961_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 50785619 - 50785396
Alignment:
| Q |
18 |
ggaacaagtagtgctccatcactcttcagcaatgttttctcccaaggaggaaacagtaacattaatgctgctgctggtactgctatatcatcaatgtcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50785619 |
ggaacaagtagtgctccatcactcttcagcaatgttttctcccaaggaggaaacagtaacattaatgctgctgctggtactgctatatcatcaatgtcag |
50785520 |
T |
 |
| Q |
118 |
caactgcacttcttcagaaagctgctcaaatgggtgcaacttcaagtaatggaaatggcactactgcgacttcgcttctcaaaagctttggaaacaatac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50785519 |
caactgcacttcttcagaaagctgctcaaatgggtgcaacttcaagtaatggaaatggcactactgcgacttcgcttctcaaaagctttggaaacaatac |
50785420 |
T |
 |
| Q |
218 |
tggtgcaagtaactcaacttcttc |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50785419 |
tggtgcaagtaactcaacttcttc |
50785396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 163
Target Start/End: Original strand, 12777569 - 12777621
Alignment:
| Q |
111 |
atgtcagcaactgcacttcttcagaaagctgctcaaatgggtgcaacttcaag |
163 |
Q |
| |
|
|||||||||||||| | ||||| |||||| |||||||||||||||||||||| |
|
|
| T |
12777569 |
atgtcagcaactgctttgcttcaaaaagcttctcaaatgggtgcaacttcaag |
12777621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 109 - 157
Target Start/End: Original strand, 40750154 - 40750202
Alignment:
| Q |
109 |
caatgtcagcaactgcacttcttcagaaagctgctcaaatgggtgcaac |
157 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| ||| |||| |
|
|
| T |
40750154 |
caatgtcagctactgcacttcttcagaaagcagctcaaataggttcaac |
40750202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University