View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17961_high_31 (Length: 235)
Name: NF17961_high_31
Description: NF17961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17961_high_31 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 101 - 235
Target Start/End: Complemental strand, 3311257 - 3311123
Alignment:
| Q |
101 |
attatgtaatatcgacgaccctaaaaggcacccattaaacatcctagaatgagggtggtggggtgtgttagttgatgattatactgatattttcggttgc |
200 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3311257 |
attatgtaatatcgacaaccctaaaagttacccattaaacaacctagaatgatggtggtggggtgtgttagttgatgattatactgatattttcggttgc |
3311158 |
T |
 |
| Q |
201 |
acaaatgggaaaagcaaaggagcatttaagagtag |
235 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |
|
|
| T |
3311157 |
gcaagtgggaaaagcaaaggagcatttaagagtag |
3311123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 53 - 122
Target Start/End: Complemental strand, 3311348 - 3311280
Alignment:
| Q |
53 |
tacaaatatcatttctccgtcattcaagtgattaacataaccctttcgattatgtaatatcgacgaccct |
122 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
3311348 |
tacaaatat-atttctccgtcgtttaagtgattaacataaccctttcaattatgtaatatcgacaaccct |
3311280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University