View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17961_high_37 (Length: 202)
Name: NF17961_high_37
Description: NF17961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17961_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 1439317 - 1439485
Alignment:
| Q |
16 |
attcttgtgcatgtcttatctcaaagattagaagtctatttgggaaggttcaagannnnnnnnnnnnnnnnn---gcaaatccagtgcatattgtctctt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1439317 |
attcttgtgcatgtcttatctcaaagattagaagtctatttgggaaggttcaagatatttatttttattttttttgcaaatccagtgcatattgtctctt |
1439416 |
T |
 |
| Q |
113 |
aaacttttccaagaagaaaaatgaaattcgattattacattatacatatatattgggaaagtcagtggatatt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1439417 |
aaacttttccaagaagaaaaatgaaattcgattattacattatac----atattgggaaagtcagtggatatt |
1439485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University