View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17961_low_15 (Length: 331)
Name: NF17961_low_15
Description: NF17961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17961_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 3e-73; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 2 - 246
Target Start/End: Original strand, 18506925 - 18507169
Alignment:
| Q |
2 |
tcttgctgcaacgatttactgatatattcagtctttgtcgatttaattagtaaaatnnnnnnnttaacac--aattatattttgcagggtttactaaagg |
99 |
Q |
| |
|
|||||||||||||||||| || | |||||| | |||||||||| ||| ||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18506925 |
tcttgctgcaacgatttattg--agattcagaccttgtcgatttgatttgtaaaataaaaaaattaacacataattatattttgcagggtttactaaagg |
18507022 |
T |
 |
| Q |
100 |
ttactgaagatggtttcagtgttatcctttcacaagtaaatggttctcaattaatgtaagttttagagaaactattcattatgagtatattgcttttctg |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
18507023 |
ttacagaagatggtttcagtgttatcctttcacaagtaaatggttctcaattaatgtaagttttagacaaataattcattatgagtatattgcttttctg |
18507122 |
T |
 |
| Q |
200 |
aataattcagttcatccatgtttagattaagtaatacaaatgatttt |
246 |
Q |
| |
|
| || |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18507123 |
ttttgtttagttcatccatgcttagattaagtaatacaaatgatttt |
18507169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 74 - 164
Target Start/End: Original strand, 18513438 - 18513528
Alignment:
| Q |
74 |
ttatattttgcagggtttactaaaggttactgaagatggtttcagtgttatcctttcacaagtaaatggttctcaattaatgtaagtttta |
164 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
18513438 |
ttatattttgcagggtttactcaaggttacagaagatggtttcagtgttatcctttcacaagtgaatggttctcaattaatgtgagtttta |
18513528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 237 - 326
Target Start/End: Original strand, 18507189 - 18507278
Alignment:
| Q |
237 |
aaatgattttaacacatcactttttatgtccaaaattttaagaatagggtatatgatcctcaataaaatgttctgtccaatatattcttc |
326 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
18507189 |
aaatgattttaacacatcactttttgtgtctaaaattttaagaatagggtatatgatcctcacttatatgttctgtccaatatattcttc |
18507278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 76 - 156
Target Start/End: Original strand, 18487071 - 18487154
Alignment:
| Q |
76 |
atattttgcagggtttactaaaggttactgaagatg---gtttcagtgttatcctttcacaagtaaatggttctcaattaatgt |
156 |
Q |
| |
|
|||||||||||||||| || |||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18487071 |
atattttgcagggtttgctcaaggttacagaagaagaaggtttcagtgttatcctttcacaagtaaatggttctcaattaatgt |
18487154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 107 - 243
Target Start/End: Original strand, 37046359 - 37046495
Alignment:
| Q |
107 |
agatggtttcagtgttatcctttcacaagtaaatggttctcaattaatgtaagttttagagaaactattcattatgagtatattgcttttctgaataatt |
206 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||| ||||| | | ||| ||||| |||| ||| |||||||||||| | || |
|
|
| T |
37046359 |
agatggtttcagtgttatcctttcccaagtaaatgtttctcaattaatgtgagtttcaaacaaataattca-tatgtgtacattgcttttctgttttgtt |
37046457 |
T |
 |
| Q |
207 |
cagttcatccatg-tttagattaagtaatacaaatgat |
243 |
Q |
| |
|
||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
37046458 |
aagttcattcatgctttagattaaataatacaaatgat |
37046495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University