View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_high_42 (Length: 249)
Name: NF17962_high_42
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_high_42 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 33322040 - 33321788
Alignment:
| Q |
13 |
attctttttagaaaactttagccgcaaactctttgacaatctttccaagttccaac--------------tg--tttgcatggcaaacagttgggcctag |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
33322040 |
attctttttagaaaactttagccgcaaactctttgacaatctttccaagttccaacgtgcaattatttggtgaatttgcatggcaaacagttgggcctag |
33321941 |
T |
 |
| Q |
97 |
attttagtgaatctcacatgaaattcacacaaaatgtattaaaaaagctaagccgctagcattgctcctcnnnnnnnnnnnnnnnnaataaaaaagaacg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
33321940 |
attttagtgaatctcacatgaaattcacacaaaatgtattaaaaaagctaagccgctagcattgctcctctttttattttgtttttaataaaaaagtacg |
33321841 |
T |
 |
| Q |
197 |
atcattaggtaattagaaaataaggtcagacagttggaatcttcttgtactgg |
249 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33321840 |
atcattaggtaattagaaaataagttcagacagttggaatcttcttgtactgg |
33321788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University