View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_high_46 (Length: 239)
Name: NF17962_high_46
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_high_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 27774920 - 27774770
Alignment:
| Q |
1 |
cacttcttctgctacaaaggggtgagactgcagctatgggaactcttgttcaatttcttggtgtgattcagtttgaacatacgccatgcacataattcaa |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774920 |
cactttttctgctacaaaggggtgagactgcagctatgggatttcttgttcaatttcttggtgtgattcagtttgaacatacgccatgcacataattcaa |
27774821 |
T |
|
| Q |
101 |
tatgatatgtgacct-aactctttgtgtagcttatctatcttatcacggta |
150 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774820 |
tatgatatgtgacctaaactctttgtgtagcttatctatcttatcacggta |
27774770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 27774734 - 27774681
Alignment:
| Q |
186 |
ccaagaccttgttcccctctgcctcccaaatgccggctttatatattgcctttg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27774734 |
ccaagaccttgttcccctctgcctcccaaatgccggctttatatattgtctttg |
27774681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 27802186 - 27802226
Alignment:
| Q |
8 |
tctgctacaaaggggtgagactgcagctatgggaactcttg |
48 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
27802186 |
tctgctacaaagaggtgggactgcagctatgggagctcttg |
27802226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University