View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17962_high_59 (Length: 210)

Name: NF17962_high_59
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17962_high_59
NF17962_high_59
[»] chr3 (1 HSPs)
chr3 (18-196)||(21121286-21121464)


Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 21121464 - 21121286
Alignment:
18 taatgtatgagtgtatatatatagaatgggactggggaagcttcatacctttcttggagaggaattctcaataagcagtactcagtctgttggcttagct 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21121464 taatgtatgagtgtatatatatagaatgggactggggaagcttcatacctttcttggagaggaattctcaataagcagtactcagtctgttggcttagct 21121365  T
118 aagttgagaaacggatgctagaaggataattgtgtggtgtttttgcactttatccttagacataagatattattattgc 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21121364 aagttgagaaacggatgctagaaggataattgtgtggtgtttttgcactttatccttagacataagatattattattgc 21121286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University