View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_high_59 (Length: 210)
Name: NF17962_high_59
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 21121464 - 21121286
Alignment:
| Q |
18 |
taatgtatgagtgtatatatatagaatgggactggggaagcttcatacctttcttggagaggaattctcaataagcagtactcagtctgttggcttagct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21121464 |
taatgtatgagtgtatatatatagaatgggactggggaagcttcatacctttcttggagaggaattctcaataagcagtactcagtctgttggcttagct |
21121365 |
T |
 |
| Q |
118 |
aagttgagaaacggatgctagaaggataattgtgtggtgtttttgcactttatccttagacataagatattattattgc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21121364 |
aagttgagaaacggatgctagaaggataattgtgtggtgtttttgcactttatccttagacataagatattattattgc |
21121286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University