View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_13 (Length: 440)
Name: NF17962_low_13
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 213 - 279
Target Start/End: Original strand, 14193669 - 14193735
Alignment:
| Q |
213 |
ttaaacagggatatttcaattctctttactttctgttggatgaaaagcttatgcaggtggtgaagat |
279 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
14193669 |
ttaaacagggatatttcaattctgtttactttctgttggatggaaagcttatgcaggtgttgaagat |
14193735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 316 - 382
Target Start/End: Original strand, 14193740 - 14193806
Alignment:
| Q |
316 |
tgaggttatttgaattttccaagttgttgattgactttgtggttttatttctctgcttgcaaattgt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
14193740 |
tgaggttatttgaattttccaagttgttgattgaccttatggttttatttctctgtttgcaaattgt |
14193806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 50 - 152
Target Start/End: Original strand, 14193515 - 14193626
Alignment:
| Q |
50 |
gacttatctggcataaaccccggctttgttatgagaccagtaggaactttatccg---------cgaaatgcaatctaatcctttgaaaatcataggagt |
140 |
Q |
| |
|
||||||| ||||||||| |||| || ||||||||||||||||||||||||| || |||||||||||||| || || ||||||| ||||||| |
|
|
| T |
14193515 |
gacttatgtggcataaatgccggattggttatgagaccagtaggaactttattcgagaaggtcgcgaaatgcaatctactcgttggaaaatcgtaggagt |
14193614 |
T |
 |
| Q |
141 |
tttggctgctac |
152 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14193615 |
tttggctgctac |
14193626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University