View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_30 (Length: 296)
Name: NF17962_low_30
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 11 - 278
Target Start/End: Original strand, 21535971 - 21536238
Alignment:
| Q |
11 |
cacagaagagtttgtgactatgatggaaggtggtagctgcactgccaacagcaaaaatgtagaaaagtttgcgactacgatggaggatggcagcaccacc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21535971 |
cacagaagagtttgtgactatgatggaaggtggtagctgcaccgccaacagcaaaaatgtagaagagtttgcgactacgatggaggatggcagcaccacc |
21536070 |
T |
|
| Q |
111 |
cccaccaacaaggcagaagagattgtgatgataatggatggtgtcagcatccccaccaccgacaataacaatgcagaaaagtttgggatgacggtggagg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21536071 |
cccaccaacaaggcagaagagattgtgatgataatggatggtgtcagcatccccaccaccgacaataacaatgcagaaaagtttgggatgacagtggagg |
21536170 |
T |
|
| Q |
211 |
atgacatcaccagcaccaccagtagcaacaatgcagaggagttttcgatgacgatggagggtggcagc |
278 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21536171 |
atgacaccaccagcaccaccagtagcaacaatgcagaggagttttcgatgacgatggagggtggcagc |
21536238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University