View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_41 (Length: 250)
Name: NF17962_low_41
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_41 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 32989405 - 32989645
Alignment:
| Q |
10 |
ataattctaacaggaaaaccatgatctggtgttaaaacgtcaccgttttgcatatatgcaagaatgatatcacgggaaggatccaatgcaacctcccttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32989405 |
ataattctaacaggaaaaccatgatctggtgttaaaacgtcaccgttttgcatatatgcaagaatgatatcacgggaaggatccaatgcaacctcccttg |
32989504 |
T |
|
| Q |
110 |
tgatactagttccatatttggatccaccaccacctggcagttcctcagcaccttcaaaacatacatagagggccccactgttacggttcaagatgccaca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32989505 |
tgatactagttccatatttggatccaccaccacctggaagttcctcagcaccttcaaaacatacatagagggccccactgttacggttcaagatgccaca |
32989604 |
T |
|
| Q |
210 |
actcttaagcacggtgcacaatggtacaccgcgccatactg |
250 |
Q |
| |
|
|||||| || |||||||||| ||||||||| |||||||||| |
|
|
| T |
32989605 |
actcttgagtacggtgcacagtggtacaccacgccatactg |
32989645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 32961751 - 32961982
Alignment:
| Q |
19 |
acaggaaaaccatgatctggtgttaaaacgtcaccgttttgcatatatgcaagaatgatatcacgggaaggatccaatgcaacctcccttgtgatactag |
118 |
Q |
| |
|
||||||||||| ||||| || | |||||| ||||| ||||||||||| || | ||||||||| | | |||||||||||||||| || |||||||| |
|
|
| T |
32961751 |
acaggaaaaccgtgatcaggagctaaaacctcaccattttgcatatacgccaaaatgatatcgctagtgcgatccaatgcaacctcgctgaggatactag |
32961850 |
T |
|
| Q |
119 |
ttccatatttggatccaccaccacctggcagttcctcagcaccttcaaaacatacatagagggccccactgttacggttcaagatgccacaactcttaag |
218 |
Q |
| |
|
|||||||||| || |||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||| || || ||||||| ||| || |
|
|
| T |
32961851 |
ttccatattttgaaccaccaccacctggaagttcctcagcaccttcaaagcatacatagagggccccacttttacggttaaatattccacaacgcttgag |
32961950 |
T |
|
| Q |
219 |
cacggtgcacaatggtacaccgcgccatactg |
250 |
Q |
| |
|
|||||| | |||||||||||| |||||||||| |
|
|
| T |
32961951 |
cacggttctcaatggtacaccacgccatactg |
32961982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University