View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_43 (Length: 249)
Name: NF17962_low_43
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 118 - 232
Target Start/End: Complemental strand, 43726515 - 43726401
Alignment:
| Q |
118 |
ccaagacattttgaatacattttgcaactatagattttagtgataattaatgcatgcatccgttatatgtggctatgcatttggggaactactagcaagc |
217 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43726515 |
ccaatacattttgtatacattttgcaactatagattttagtgataattaatgtatgcatccgttatatgtggctatgcatttggggaactactagcaagc |
43726416 |
T |
|
| Q |
218 |
taaagacaaatcttt |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43726415 |
taaagacaaatcttt |
43726401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 43726601 - 43726496
Alignment:
| Q |
1 |
ttctcaacttgaccattgttttttctacgatgaatttcaaacatgtattataaacttgaacattggagtgatgaagttgactttgaccaatacattttgt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43726601 |
ttctcaacttgactattgttttttctacgatgaatttcaaacatgtattataaacttgaacattggagtgatgaagttgactttgaccaatacattttgt |
43726502 |
T |
|
| Q |
101 |
atacat |
106 |
Q |
| |
|
|||||| |
|
|
| T |
43726501 |
atacat |
43726496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University