View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_45 (Length: 249)
Name: NF17962_low_45
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 235
Target Start/End: Original strand, 4677810 - 4678033
Alignment:
| Q |
12 |
atgaatatttagaggttttnnnnnnngttgttttgtttatcataatgaaaattattttatttctatttttaaaaatcatctattgacaaagaaaagctac |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4677810 |
atgaatatttagaggttttaaaaaaagttgttttgtttatcataatgaaaattattttatttctatttttaaaaatcatctattgacaaagaaaagctac |
4677909 |
T |
 |
| Q |
112 |
tctaatgaagttgtgtagctattcttgatattgtcattaatgactatcaaatacaattgttgcaatctcaatcgtagatgcgatgtgattacaacaacga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4677910 |
tctaatgaagttgtgtagctattcttgatattgtcattaatgactatcaaatacaattgttgtaatctcaatcgtagatgcgatgtgattacaacaacga |
4678009 |
T |
 |
| Q |
212 |
aaataaattatagagttgtggttg |
235 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
4678010 |
aaataaattatagacttgtggttg |
4678033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University