View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_49 (Length: 241)
Name: NF17962_low_49
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 90 - 227
Target Start/End: Original strand, 54269903 - 54270034
Alignment:
| Q |
90 |
gttcaagggtggagagcaatttgaaactatactacata-tatactattctagctataatacttaagatagaatttgaactagacatgcaaattagtagct |
188 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54269903 |
gttcaagggtggagaggaatttgaaactatactacatactata-tattctagctata---cttaagatagaatttgaactagacatgcaaa---gtagct |
54269995 |
T |
|
| Q |
189 |
agctatagtatcttgttcatgttggtgggagtagaaaat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54269996 |
agctatagtatcttgttcatgttggtgggagtagaaaat |
54270034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 54269760 - 54269835
Alignment:
| Q |
1 |
accactctctttctcccatctttgccatttctgcacacaattcaagagaagtggttcaaccccctccctacttaac |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54269760 |
accactctctttctcccatctttgccatttctgcacacaattcaagagaagtggttcaaccccctccctacttaac |
54269835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University