View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_56 (Length: 236)
Name: NF17962_low_56
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 37602305 - 37602525
Alignment:
| Q |
1 |
aatagtgatggaatatgctgctgggggagaactatttgaaagaatttgtactgctggtagattcagtgaggacgaggtagtttattataataagccatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37602305 |
aatagtgatggaatatgctgctgggggagaactatttgaaagaatttgtactgctggtagattcagtgaggacgaggtagtttattataataagccatta |
37602404 |
T |
 |
| Q |
101 |
tcttaattaactgttctagattctagaaaacagtaagtaggatttcatgcaagtaatatattaacaagtgggggtacnnnnnnncatcttggnnnnnnna |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
37602405 |
tcttaattaactgttctagattctagaaaacagtaattaggatttcatgcaagtaatatattaacaagtgggggtactttttttcatcttggttttttta |
37602504 |
T |
 |
| Q |
201 |
atgttacacatgcacagtatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37602505 |
atgttacacatgcacagtatt |
37602525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 80
Target Start/End: Original strand, 39410996 - 39411074
Alignment:
| Q |
2 |
atagtgatggaatatgctgctgggggagaactatttgaaagaatttgtactgctggtagattcagtgaggacgaggtag |
80 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||| || | |||||||||||| |||| |||||||||| |
|
|
| T |
39410996 |
atagtgatggagtatgctgcaggaggagaactatttgaaagaatatgcagtgctggtagattttgtgaagacgaggtag |
39411074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 78
Target Start/End: Original strand, 543096 - 543172
Alignment:
| Q |
2 |
atagtgatggaatatgctgctgggggagaactatttgaaagaatttgtactgctggtagattcagtgaggacgaggt |
78 |
Q |
| |
|
||||| ||||| ||||||||||| ||||| || ||||| ||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
543096 |
atagttatggagtatgctgctggtggagagctctttgaccgaatttgctctgctggaagattcagtgaagacgaggt |
543172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University