View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_59 (Length: 235)
Name: NF17962_low_59
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 27 - 140
Target Start/End: Complemental strand, 51530857 - 51530753
Alignment:
| Q |
27 |
tatatagttgaggatgactgatagaagcaacaatataattaaagcgtgtctgttcagacatgataataggaaattctagaataattaaaatattaggtaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51530857 |
tatatagttgaggatgactgatagaagcaacaat-----taaagcgtgt----tcagacatgataataggaaattctagaataattaaaatattaggtaa |
51530767 |
T |
|
| Q |
127 |
ttcaaatacttcaa |
140 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51530766 |
ctcaaatacttcaa |
51530753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University