View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_62 (Length: 229)
Name: NF17962_low_62
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_62 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 5 - 229
Target Start/End: Complemental strand, 43726841 - 43726619
Alignment:
| Q |
5 |
aaaactacattcttctcttctatgttataaatatatattcttttttactcccacnnnnnnnnnnnnnnnnngggaatttttggtattttattactagctt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43726841 |
aaaactacattcttctcttctatgttataaatatatattcttttttactcccacttttttttttctttt--gggaatttttggtattttattactagctt |
43726744 |
T |
 |
| Q |
105 |
catatggtttggctgtatttgttaattttgccataattttgnnnnnnngctaacatgttagagacagtttgttattaaggatgatgtgtatctaagaaaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43726743 |
catatggtttggctgtatttgttaattttgccataattttgtttttttgctaacatgttagagacagtttgttattaaggatgatgtgtatctaagaaaa |
43726644 |
T |
 |
| Q |
205 |
aacatgttctttgtttcttcctcct |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43726643 |
aacatgttctttgtttcttcctcct |
43726619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University