View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_65 (Length: 213)
Name: NF17962_low_65
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_65 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 119 - 213
Target Start/End: Complemental strand, 2786337 - 2786243
Alignment:
| Q |
119 |
aaatcttcccaaaatcaaagccatctacaatgctggagctgtcaatccacctgttgatgcgaaaccccctcttgttttgatatcagaaggtttca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2786337 |
aaatcttcccaaaatcaaagccatctacaatgctggagctgtcaatccaccggttgatgctaaaccccctcttgttttgatatcagaaggtttca |
2786243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University